| Detail of EST/Unigene EX527902 |
| Acc. | EX527902 |
| Internal Acc. | MTGland_A034_2007-05-23/MTGlandA034_F05_019_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Replication protein A 70 kDa DNA-binding subunit OS=Xenopus tropicalis E-value=7e-08; Replication protein A 70 kDa DNA-binding subunit OS=Xenopus laevis E-value=6e-07; Probable replication factor A 73 kDa subunit OS=Caenorhabditis briggsae E-value=1e-06; Probable replication factor A 73 kDa subunit OS=Caenorhabditis elegans E-value=1e-06; Replication factor A protein 1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-06; |
| Length | 483 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_TRI; |
| Sequence | AGTGCAACTTCAGATATATTATGGTTGCAAAAGTTTCTGATGCAAGTGGTGAGGCTTTCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K07466 replication factor A1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836221 |
| Trichome-related Gene from Literature | N/A |