Detail of EST/Unigene EX529652 |
Acc. | EX529652 |
Internal Acc. | MTGland_A057_2007-06-13/MTGlandA057_A08_032_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 98A2 OS=Glycine max E-value=0; Cytochrome P450 98A3 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 98A1 OS=Sorghum bicolor E-value=0; Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-35; Cytochrome P450 750A1 OS=Pinus taeda E-value=3e-32; |
Length | 966 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_TRI; |
Sequence | TTCCTCTTTTACACACTCTTCCGAAGACTGAGATTCAAGCTTCCACCCGGTCCACGACCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818686 |
Trichome-related Gene from Literature | N/A |