| Detail of EST/Unigene EX533009 |
| Acc. | EX533009 |
| Internal Acc. | MTGland_B044_2007-06-23/MTGlandB044_B07_031_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=5e-21; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Zea mays E-value=2e-19; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=4e-19; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=2e-18; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=2e-18; |
| Length | 368 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_TRI; |
| Sequence | GTCCGAGAGTGGGTGGNCATCTGCAGGTGGAGATAGTGCCTCAACGGACAACGCTGCCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824891 |
| Trichome-related Gene from Literature | N/A |