Detail of EST/Unigene EX533140 |
Acc. | EX533140 |
Internal Acc. | MTGland_B045_2007-06-07/MTGlandB045_G09_034_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=2e-12; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Zea mays E-value=2e-12; Glucan endo-1,3-beta-glucosidase GI OS=Hordeum vulgare E-value=4e-12; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=7e-12; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=3e-11; |
Length | 453 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_TRI; |
Sequence | AAGAGACCCGGAGCTATTGAGACTTACTTGTTTGCCATGTTTGATGAAAATCAGAAGACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824891 |
Trichome-related Gene from Literature | N/A |