| Detail of EST/Unigene EX533945 |
| Acc. | EX533945 |
| Internal Acc. | NBT100_2007-07-03/NBT100_B08_031_1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Shaggy-related protein kinase eta OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase iota OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase zeta OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase epsilon OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase alpha OS=Arabidopsis thaliana E-value=0; |
| Length | 936 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_TRI (1 ESTs); |
| Sequence | ACATTTTTGGAGCTGGAAAATTATGGCTGATGATAAGGAGATGTCTGCTCCTGTTATGGA |
| EST members of Unigene | EX533945 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
| EC | 2.7.11.26 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
|
| Corresponding NCBI Gene | 827605 |
| Trichome-related Gene from Literature | 827605 |