Detail of EST/Unigene EY035598 |
Acc. | EY035598 |
Internal Acc. | CAIY2254.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=0; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=0; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=0; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=0; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=0; |
Length | 759 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY; |
Sequence | CTTGAACTCATCCCATCAGAGAACTTTACCTCACTATCAGTGATGCAAGCAGTTGGATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829949 |
Trichome-related Gene from Literature | 829949 |