Detail of EST/Unigene EY037325 |
Acc. | EY037325 |
Internal Acc. | CAIY3220.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Solanum tuberosum E-value=1e-23; Cysteine synthase OS=Citrullus lanatus E-value=3e-23; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=2e-22; Cysteine synthase OS=Zea mays E-value=7e-22; Cysteine synthase OS=Spinacia oleracea E-value=9e-22; |
Length | 497 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY; |
Sequence | GATCTTATCGATGAAGTCGTTCAAATTTCAAGTGAAGAGTCCATCGAAACTGCAAAGCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821817 |
Trichome-related Gene from Literature | N/A |