Detail of EST/Unigene EY037754 |
Acc. | EY037754 |
Internal Acc. | CAIY3461.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-17; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=9e-17; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=8e-16; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=1e-15; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=2e-15; |
Length | 509 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY; |
Sequence | GATGAAGCTGTTGAGACTGCAAAGCAATTGGCACTCCAAGAAGGCTTGTTGGTGGGCATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.5.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |