Detail of EST/Unigene EY039614 |
Acc. | EY039614 |
Internal Acc. | CAIY4789.rev |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-25; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=6e-25; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=6e-25; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=6e-25; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=6e-25; |
Length | 226 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY; |
Sequence | ACCCAAAACTATCAATATATTAATTCACATATCATTTTACAGCAAACTTCATTACATTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815055 |
Trichome-related Gene from Literature | N/A |