| Detail of EST/Unigene EY039985 |
| Acc. | EY039985 |
| Internal Acc. | CAIY4978.rev |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=2e-06; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-06; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=2e-06; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-06; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=2e-06; |
| Length | 163 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAIY; |
| Sequence | GCCCAAAATTAAACCATATATTACTAATAATAATTCACAAACAATATGACATCAATAAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815055 |
| Trichome-related Gene from Literature | N/A |