Detail of EST/Unigene EY041721 |
Acc. | EY041721 |
Internal Acc. | CAIY5859.rev |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-90; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=4e-90; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=5e-90; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=7e-90; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=9e-90; |
Length | 600 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY; |
Sequence | AGTCTGAACTTTTAAATGTCATTATATATATCCTCCAGTAATTCGCAAGATAAAATATAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |