| Detail of EST/Unigene EY042464 |
| Acc. | EY042464 |
| Internal Acc. | CAIY6236.fwd |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=5e-20; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=5e-20; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=5e-20; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=5e-20; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-19; |
| Length | 131 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAIY; |
| Sequence | CAGACCGTGTCAAGTACCTAGGCCCATTCTCTGGTGAGGCTCCATCATACCTCACTGGTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |