Detail of EST/Unigene EY043014 |
Acc. | EY043014 |
Internal Acc. | CAIY6509.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=3e-46; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-46; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-45; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=3e-45; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=3e-45; |
Length | 281 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY; |
Sequence | GAGCCCAGATCTTTAGCGAAGGTGGTCTTGACTACTTGGGTAACCCAAGCTTGGTCCATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |