| Detail of EST/Unigene EY043120 |
| Acc. | EY043120 |
| Internal Acc. | CAIY6566.rev |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-29; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-28; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=5e-28; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=1e-27; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=3e-26; |
| Length | 748 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAIY; |
| Sequence | GAAGGAGAACAAAGCCATTGAGCAAATTACATTAACAAATGTCAAGTGGTTCACAACAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |