Detail of EST/Unigene EY043120 |
Acc. | EY043120 |
Internal Acc. | CAIY6566.rev |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-29; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-28; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=5e-28; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=1e-27; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=3e-26; |
Length | 748 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY; |
Sequence | GAAGGAGAACAAAGCCATTGAGCAAATTACATTAACAAATGTCAAGTGGTTCACAACAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |