Detail of EST/Unigene EY045424 |
Acc. | EY045424 |
Internal Acc. | CAIY7759.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-84; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=3e-84; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=9e-84; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-83; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=3e-83; |
Length | 562 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY; |
Sequence | CTTGGATGTGTTTTCCCCGAGCTTTTGGCCCGTATCGGGGTTAAGTTCGGTGAGGCTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |