| Detail of EST/Unigene EY051071 |
| Acc. | EY051071 |
| Internal Acc. | CATC2947.rev |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Lichenase OS=Nicotiana plumbaginifolia E-value=2e-19; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=6e-19; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=2e-18; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-O (Fragment) OS=Nicotiana tabacum E-value=2e-18; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=5e-18; |
| Length | 366 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_GTRI3 (1 ESTs); |
| Sequence | GCACACAAAAAAAAGCACGATTAATTATTTTACCATTATTACAAGAAGAAATACATAAAA |
| EST members of Unigene | EY051071 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |