Detail of EST/Unigene EY051072 |
Acc. | EY051072 |
Internal Acc. | CATC2947.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Lichenase OS=Nicotiana plumbaginifolia E-value=2e-19; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=6e-19; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=2e-18; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-O (Fragment) OS=Nicotiana tabacum E-value=2e-18; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=5e-18; |
Length | 372 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_GTRI3 (1 ESTs); |
Sequence | CAGCTGGTGCGTTTGGAGCAACATTAGAAAATGCAAGTAATTTCTACAAGAATATGGTTG |
EST members of Unigene | EY051072 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |