| Detail of EST/Unigene EY065001 |
| Acc. | EY065001 |
| Internal Acc. | CATF859.fwd |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=0; |
| Length | 680 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_GTRI4 (1 ESTs); |
| Sequence | TTCTTCAACCATGGCTCTCTCATCTCCTTTCGCTGGACAAGCCGTGAAAGCGGCTCCATC |
| EST members of Unigene | EY065001 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |