Detail of EST/Unigene EY069473 |
Acc. | EY069473 |
Internal Acc. | CATG2380.rev |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=7e-31; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=1e-30; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=2e-30; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=2e-30; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=2e-30; |
Length | 258 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_GTRI5; |
Sequence | GCAAAACTATCAATATATTAATTCACATATCATTTTACAGCAAACTTCATTACATTTACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815055 |
Trichome-related Gene from Literature | N/A |