| Detail of EST/Unigene EY077458 |
| Acc. | EY077458 |
| Internal Acc. | CAZI12807.fwd |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcium-dependent protein kinase 4 OS=Solanum tuberosum E-value=0; Calcium-dependent protein kinase 5 OS=Solanum tuberosum E-value=0; Calcium-dependent protein kinase 6 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase 5 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase 26 OS=Arabidopsis thaliana E-value=0; |
| Length | 831 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI (1 ESTs); |
| Sequence | CACAGAGACTTGAAACCTGAAAATTTCTTGTTGGTCAATAGAGATGACGATTTCTCTCTC |
| EST members of Unigene | EY077458 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II |
| EC | 2.7.11.17 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816235 |
| Trichome-related Gene from Literature | 816235 |