Detail of EST/Unigene EY079896 |
Acc. | EY079896 |
Internal Acc. | CAZI14037.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=4e-40; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=9e-40; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-39; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=8e-37; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=3e-36; |
Length | 720 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (1 ESTs); |
Sequence | GGACCACAGTCACATAATTCGCTAGAAACGCCACGAATCGCGATCCAGTTCACGCGTTCC |
EST members of Unigene | EY079896 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |