| Detail of EST/Unigene EY080536 |
| Acc. | EY080536 |
| Internal Acc. | CAZI14361.fwd |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase OS=Rhodospirillum centenum (strain ATCC 51521 / SW) E-value=1e-93; |
| Length | 829 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI (1 ESTs); |
| Sequence | CTTGACGGTCCTATACCACCCGTTGGAGCATTAAGTAGTGCTCTTAGTAGATTACAATCT |
| EST members of Unigene | EY080536 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |