| Detail of EST/Unigene EY090229 |
| Acc. | EY090229 |
| Internal Acc. | CAZI19277.rev |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=4e-67; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=2e-66; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=1e-65; Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=8e-63; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=2e-62; |
| Length | 721 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI (1 ESTs); |
| Sequence | ATGACTATAGACGTCGCCAAATTCATTTTTCTATTGCTTGCATTTATTACTGTACGTGTG |
| EST members of Unigene | EY090229 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829949 |
| Trichome-related Gene from Literature | 829949 |