Detail of EST/Unigene EY102792 |
Acc. | EY102792 |
Internal Acc. | CAZI25944.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Calcium-dependent protein kinase 4 OS=Solanum tuberosum E-value=0; Calcium-dependent protein kinase 5 OS=Solanum tuberosum E-value=0; Calcium-dependent protein kinase 6 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase 26 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase 5 OS=Arabidopsis thaliana E-value=0; |
Length | 704 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (1 ESTs); |
Sequence | GATTTCTCACTCAAGGCCATTGATTTTGGACTCTCAGTTTTCTTCAAGCCAGGTCAAATT |
EST members of Unigene | EY102792 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II |
EC | 2.7.11.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816235 |
Trichome-related Gene from Literature | 816235 |