| Detail of EST/Unigene EY108176 |
| Acc. | EY108176 |
| Internal Acc. | CAZI5628.fwd |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=9e-29; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=1e-24; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-23; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=2e-22; 30S ribosomal protein S17 OS=Rhodobacter sphaeroides (strain KD131 / KCTC 12085) E-value=5e-11; |
| Length | 531 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI (1 ESTs); |
| Sequence | CAAAACACAATGTCTCTCCTCACCAATTTCAAATCCCTCACACTCTCCACCCCCTTCCTC |
| EST members of Unigene | EY108176 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844324 |
| Trichome-related Gene from Literature | 844324 |