Detail of EST/Unigene EY114910 |
Acc. | EY114910 |
Internal Acc. | CAZI9099.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=4e-46; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=9e-46; Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=2e-45; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=1e-44; Putative gamma-glutamyltranspeptidase 3 OS=Homo sapiens E-value=3e-41; |
Length | 736 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (1 ESTs); |
Sequence | TTTAGGAATGCCAGCACCGTCAAGTGGTACGTTGGGGCTAGCTCTGGTGTCAAACATCTT |
EST members of Unigene | EY114910 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829042 |
Trichome-related Gene from Literature | 829042 |