Detail of EST/Unigene EY473980 |
Acc. | EY473980 |
Internal Acc. | META043TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Succinate-semialdehyde dehydrogenase (acetylating) OS=Metallosphaera sedula (strain ATCC 51363 / DSM 5348) E-value=1e-42; S-(hydroxymethyl)mycothiol dehydrogenase OS=Amycolatopsis methanolica E-value=4e-27; Sorbitol dehydrogenase OS=Bacillus subtilis (strain 168) E-value=4e-26; Probable S-(hydroxymethyl)glutathione dehydrogenase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-25; Alcohol dehydrogenase 1 OS=Naja naja E-value=6e-24; |
Length | 879 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GCAAATGCATTGGCGGTATTGCCAAATTCAATGCCATATACCGAGTCTGCAATACTAGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836482 |
Trichome-related Gene from Literature | N/A |