Detail of EST/Unigene EY474011 |
Acc. | EY474011 |
Internal Acc. | META074TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC8 OS=Arabidopsis thaliana E-value=7e-67; Rac-like GTP-binding protein ARAC10 OS=Arabidopsis thaliana E-value=2e-66; Rac-like GTP-binding protein 4 OS=Oryza sativa subsp. japonica E-value=1e-65; Rac-like GTP-binding protein 3 OS=Oryza sativa subsp. japonica E-value=3e-65; Rac-like GTP-binding protein ARAC5 OS=Arabidopsis thaliana E-value=1e-60; |
Length | 557 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | ATACATAAACACACAAACTCTCTCTTTTCTCATCTAACAAAAACAAAACACTCATTTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
Probeset |
|
Corresponding NCBI Gene | 823959 |
Trichome-related Gene from Literature | N/A |