Detail of EST/Unigene EY474437 |
Acc. | EY474437 |
Internal Acc. | META546TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC7 OS=Arabidopsis thaliana E-value=3e-93; Rac-like GTP-binding protein 2 OS=Oryza sativa subsp. japonica E-value=2e-89; Rac-like GTP-binding protein 1 OS=Oryza sativa subsp. japonica E-value=6e-86; Rac-like GTP-binding protein ARAC8 OS=Arabidopsis thaliana E-value=3e-83; Rac-like GTP-binding protein 3 OS=Oryza sativa subsp. japonica E-value=3e-83; |
Length | 753 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GATACCAAAATCCAGAACACCCTTTCTTCATTTACTTCACACTCTTCAAATCTCAATCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
Probeset |
|
Corresponding NCBI Gene | 829016 |
Trichome-related Gene from Literature | 829016 |