Detail of EST/Unigene EY474564 |
Acc. | EY474564 |
Internal Acc. | META682TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein At1g69295 OS=Arabidopsis thaliana E-value=6e-13; Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=8e-13; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=2e-12; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=6e-09; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=3e-08; |
Length | 209 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | TTATGCTTGTGGAACTGGTGCTGATTGTAGCCCTATTCTCCAAAATGGACCTTGTTTCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838446 |
Trichome-related Gene from Literature | N/A |