| Detail of EST/Unigene EY474961 |
| Acc. | EY474961 |
| Internal Acc. | METAB12TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=0; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=0; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=0; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=0; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=0; |
| Length | 681 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | AAGGAGTTGCATTTCAACAAAGATGGTTCCGCTATCAAGAAACTCCAGAATGGTGTGAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820549 |
| Trichome-related Gene from Literature | N/A |