| Detail of EST/Unigene EY475021 |
| Acc. | EY475021 |
| Internal Acc. | METAB74TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S19, mitochondrial OS=Petunia hybrida E-value=5e-26; 40S ribosomal protein S19, mitochondrial OS=Arabidopsis thaliana E-value=2e-22; Ribosomal protein S19, mitochondrial OS=Marchantia polymorpha E-value=2e-13; Ribosomal protein S19, mitochondrial OS=Prototheca wickerhamii E-value=1e-11; Ribosomal protein S19, mitochondrial OS=Platymonas subcordiformis E-value=3e-11; |
| Length | 684 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | GAGTCGCACTCAAAAACTCAACTAACTCCCGGAAATCGCCGTCGGAGTTTCCCAGTCGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834779 |
| Trichome-related Gene from Literature | N/A |