| Detail of EST/Unigene EY475200 |
| Acc. | EY475200 |
| Internal Acc. | METAD69TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 2 OS=Rattus norvegicus E-value=4e-77; Replication factor C subunit 2 OS=Mus musculus E-value=7e-77; Replication factor C subunit 4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-76; Replication factor C subunit 2 OS=Homo sapiens E-value=3e-76; Replication factor C subunit 2 OS=Gallus gallus E-value=3e-76; |
| Length | 697 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | CCTTAGAACTTAGAAACTCCCTCCAAGTTTGAAGCCAGTTCGCCATATAGGGTTTCGTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842620 |
| Trichome-related Gene from Literature | N/A |