Detail of EST/Unigene EY475516 |
Acc. | EY475516 |
Internal Acc. | METAH21TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 1, mitochondrial OS=Glycine max E-value=6e-71; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=1e-69; Alternative oxidase 1b, mitochondrial OS=Arabidopsis thaliana E-value=1e-66; Alternative oxidase 1c, mitochondrial OS=Arabidopsis thaliana E-value=2e-65; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=1e-63; |
Length | 594 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GCGAGAGCGAGCGCATGCATCTAATGACTTTCATGGAAGTGGCAAAACCAAAGTGGTATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821806 |
Trichome-related Gene from Literature | N/A |