Detail of EST/Unigene EY475525 |
Acc. | EY475525 |
Internal Acc. | METAH30TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=1e-38; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-37; Ferredoxin-6, chloroplastic OS=Zea mays E-value=6e-33; Ferredoxin, root R-B1 OS=Raphanus sativus E-value=1e-32; Ferredoxin, root R-B2 OS=Raphanus sativus E-value=2e-32; |
Length | 772 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GTTTGGCACTTTCCTTCTCTCCTTTTCTCGTGACTTCCTTCACAGCGCTCTCCGACAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817297 |
Trichome-related Gene from Literature | N/A |