Detail of EST/Unigene EY475606 |
Acc. | EY475606 |
Internal Acc. | METAI21TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Mus musculus E-value=6e-13; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Homo sapiens E-value=6e-13; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Bos taurus E-value=6e-13; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-12; DNA-directed RNA polymerases I, II, and III subunit rpabc4 OS=Dictyostelium discoideum E-value=1e-09; |
Length | 364 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | ACAGAGAACCCTCTCTTTCGTTACAATTCATCAATTACCAATTCCTAGTGATGGATCCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03009 DNA-directed RNA Polymerase II subunit K |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834103 |
Trichome-related Gene from Literature | N/A |