Detail of EST/Unigene EY475652 |
Acc. | EY475652 |
Internal Acc. | METAI70TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Histidine decarboxylase OS=Solanum lycopersicum E-value=2e-79; Histidine decarboxylase OS=Vibrio anguillarum (strain ATCC 68554 / 775) E-value=9e-43; Histidine decarboxylase OS=Vibrio harveyi (strain ATCC BAA-1116 / BB120) E-value=4e-42; Histidine decarboxylase OS=Morganella morganii E-value=7e-40; Histidine decarboxylase OS=Pseudomonas entomophila (strain L48) E-value=9e-40; |
Length | 712 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GCTTCTTCGCCACCAAGACAAACCAGCAATTATAAATGTGAACATAGGTACAACTGTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01580 glutamate decarboxylase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01580 glutamate decarboxylase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01580 glutamate decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K01580 glutamate decarboxylase |
EC | 4.1.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840958 |
Trichome-related Gene from Literature | N/A |