Detail of EST/Unigene EY475683 |
Acc. | EY475683 |
Internal Acc. | METAJ05TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Inactive hydroxysteroid dehydrogenase-like protein 1 OS=Homo sapiens E-value=4e-35; Inactive hydroxysteroid dehydrogenase-like protein 1 OS=Pongo abelii E-value=2e-34; Estradiol 17-beta-dehydrogenase 12 OS=Homo sapiens E-value=3e-34; Estradiol 17-beta-dehydrogenase 12 OS=Rattus norvegicus E-value=5e-34; Estradiol 17-beta-dehydrogenase 12 OS=Macaca fascicularis E-value=5e-34; |
Length | 849 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | ACAACACATGGATCTGCCTCATAATTTCTTCCTACTAGCAACAGCCCTCTTAGGATTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
EC | 1.1.1.- 1.1.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843098 |
Trichome-related Gene from Literature | N/A |