| Detail of EST/Unigene EY475724 |
| Acc. | EY475724 |
| Internal Acc. | METAJ47TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Triosephosphate isomerase, chloroplastic OS=Arabidopsis thaliana E-value=4e-96; Triosephosphate isomerase, chloroplastic OS=Spinacia oleracea E-value=1e-94; Triosephosphate isomerase, chloroplastic OS=Fragaria ananassa E-value=1e-94; Triosephosphate isomerase, chloroplastic OS=Secale cereale E-value=8e-84; Triosephosphate isomerase, cytosolic OS=Stellaria longipes E-value=1e-61; |
| Length | 826 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | CCCACCAAACACAAAAACAAAAAGCTGATCCAGAACTCGTTACTTCCAACCCACAAGCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K01803 triosephosphate isomerase (TIM); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01803 triosephosphate isomerase (TIM); Metabolism > Carbohydrate Metabolism > ko00031 Inositol metabolism > K01803 triosephosphate isomerase (TIM); Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01803 triosephosphate isomerase (TIM) |
| EC | 5.3.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816652 |
| Trichome-related Gene from Literature | N/A |