Detail of EST/Unigene EY475754 |
Acc. | EY475754 |
Internal Acc. | METAJ78TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=4e-97; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-81; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-75; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-62; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-60; |
Length | 774 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GCCTTACCTTCCACAAACCAAAATCACTTCAATTAATGTAGGAAATGAAGTATTAGGTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817295 |
Trichome-related Gene from Literature | N/A |