| Detail of EST/Unigene EY475754 |
| Acc. | EY475754 |
| Internal Acc. | METAJ78TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=4e-97; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-81; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-75; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-62; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-60; |
| Length | 774 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | GCCTTACCTTCCACAAACCAAAATCACTTCAATTAATGTAGGAAATGAAGTATTAGGTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817295 |
| Trichome-related Gene from Literature | N/A |