Detail of EST/Unigene EY475762 |
Acc. | EY475762 |
Internal Acc. | METAJ86TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A8 OS=Mentha piperita E-value=8e-70; Cytochrome P450 71A4 OS=Solanum melongena E-value=2e-61; Cytochrome P450 71A26 OS=Arabidopsis thaliana E-value=7e-60; Cytochrome P450 71A2 OS=Solanum melongena E-value=2e-59; Cytochrome P450 71A25 OS=Arabidopsis thaliana E-value=4e-59; |
Length | 698 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | ATGTTGGAGTTTGGAGAGTTGTTGGGTTCATTCTTTATAGGAGATTATATACCTTGGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823985 |
Trichome-related Gene from Literature | N/A |