| Detail of EST/Unigene EY476248 |
| Acc. | EY476248 |
| Internal Acc. | METAP23TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Presenilin-like protein At1g08700 OS=Arabidopsis thaliana E-value=8e-56; Presenilin-like protein At2g29900 OS=Arabidopsis thaliana E-value=1e-32; Presenilin-2 OS=Xenopus laevis E-value=5e-08; Presenilin-2 OS=Mus musculus E-value=6e-08; Presenilin-2 (Fragment) OS=Microcebus murinus E-value=6e-08; |
| Length | 764 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | GAAAAAAGTAAACAAAAACTCAAGCTTAGTACCCCCTCATAGAAGAATTAAACTCATCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04505 presenilin 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04505 presenilin 1; Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04522 presenilin 2 |
| EC | 3.4.23.- |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.5 Polycystin cation channel PCC |
| Probeset |
|
| Corresponding NCBI Gene | 837391 |
| Trichome-related Gene from Literature | N/A |