Detail of EST/Unigene EY476335 |
Acc. | EY476335 |
Internal Acc. | METAQ20TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=2e-78; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=7e-50; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=1e-48; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=9e-47; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=6e-46; |
Length | 784 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | AGTAACTGGAGCACTACGATGGCATCAAACAAGGAAGAGGTGAAGCTTTTTGGAATGAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00310 pyrimidodiazepine synthase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 1.5.4.1 1.8.5.1 2.5.1.18 2.8.-.- |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 817491 |
Trichome-related Gene from Literature | N/A |