Detail of EST/Unigene EY476339 |
Acc. | EY476339 |
Internal Acc. | METAQ24TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=2e-81; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=9e-75; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=2e-62; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=2e-42; Cytochrome P450 93A3 OS=Glycine max E-value=2e-41; |
Length | 730 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GAAAAGAGGCTTAAGAAGATTAGTAAGAGAACCGATGCATTTTTACAAGGGCTTATTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829889 |
Trichome-related Gene from Literature | N/A |