Detail of EST/Unigene EY476409 |
Acc. | EY476409 |
Internal Acc. | METAR09TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; Argininosuccinate synthase OS=Roseiflexus sp. (strain RS-1) E-value=5e-78; Argininosuccinate synthase OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) E-value=2e-77; Argininosuccinate synthase OS=Desulfotomaculum reducens (strain MI-1) E-value=2e-76; Argininosuccinate synthase OS=Desulfitobacterium hafniense (strain Y51) E-value=5e-75; |
Length | 683 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GGTTGCTGGACTAAAAGGTAAATTGAATAAGGTTGTTCTGGCTTATAGTGGTGGCTTAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
EC | 6.3.4.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828586 |
Trichome-related Gene from Literature | N/A |