Detail of EST/Unigene EY476751 |
Acc. | EY476751 |
Internal Acc. | METAU81TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Primary amine oxidase OS=Arabidopsis thaliana E-value=0; Primary amine oxidase (Fragment) OS=Lens culinaris E-value=4e-72; Primary amine oxidase OS=Pisum sativum E-value=3e-71; Copper methylamine oxidase OS=Arthrobacter sp. (strain P1) E-value=5e-31; Primary amine oxidase OS=Arthrobacter sp. (strain P1) E-value=5e-31; |
Length | 734 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | GTCAAACAGATGGGCTAATCAGATCCAAGGTTGGACTAAGTGGTATCTTGATGGTGAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K11182 diamine oxidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K11182 diamine oxidase |
EC | 1.4.3.22 1.4.3.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826838 |
Trichome-related Gene from Literature | N/A |