| Detail of EST/Unigene EY476771 |
| Acc. | EY476771 |
| Internal Acc. | METAV06TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=1e-74; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=4e-74; Glutathione S-transferase OS=Hyoscyamus muticus E-value=2e-73; Glutathione S-transferase F7 OS=Arabidopsis thaliana E-value=2e-68; Glutathione S-transferase F6 OS=Arabidopsis thaliana E-value=7e-68; |
| Length | 740 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | ACTTACCAAAGTTAATTAAGAACAATAAATTAATCTTGTGATCGATTAATCTTGTAAATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839295 |
| Trichome-related Gene from Literature | N/A |