| Detail of EST/Unigene EY476813 |
| Acc. | EY476813 |
| Internal Acc. | METAV50TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-50; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-47; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-45; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=5e-42; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=7e-36; |
| Length | 563 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3; |
| Sequence | AACTTTGATCAAAACAAGCCTTGTTTCATCCTGGCGTGGAAACAGAAACCAGCAACGTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837379 |
| Trichome-related Gene from Literature | N/A |