Detail of EST/Unigene EY477021 |
Acc. | EY477021 |
Internal Acc. | METAY13TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=4e-69; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=3e-41; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-33; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=8e-32; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=5e-31; |
Length | 587 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | CTCACGTGGAGACAACAATGAAGTAGGACCAAGTGTTGAAAATGCCAAAGCCTATAATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |