Detail of EST/Unigene EY477201 |
Acc. | EY477201 |
Internal Acc. | METB044TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosome biogenesis protein NSA2 OS=Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294) E-value=7e-15; Ribosome biogenesis protein NSA2 OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) E-value=9e-15; Ribosome biogenesis protein NSA2 OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=2e-14; Ribosome biogenesis protein NSA2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-14; Ribosome biogenesis protein NSA2 OS=Saccharomyces cerevisiae (strain YJM789) E-value=3e-14; |
Length | 274 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3; |
Sequence | TCGGTAAACGCAGCCGGAGTTTTTCAGCCAAAGAGTTACATTACATATACGAAGAACCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K00914 phosphatidylinositol 3-kinase; Genetic Information Processing > Folding, Sorting and Degradation > ko04140 Regulation of autophagy > K00914 phosphatidylinositol 3-kinase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K00914 phosphatidylinositol 3-kinase |
EC | 2.7.1.137 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830524 |
Trichome-related Gene from Literature | N/A |